synchrony bank credit card login pc richard

Login; Register BrandsMart USA Credit Card. BrandsMart USA offers customers a credit card through Synchrony Bank that can be used in-store and online. PC Richard & Son Credit Card - benefits that makes transactions rewarding. This no-annual-fee credit card is issued by Synchrony Financial Institution. Is it hard to get a PC Richards credit card? How do I pay my synchrony bank bill? Can I pay synchrony bank with debit card? Is Capital One a synchrony bank?

: Synchrony bank credit card login pc richard

Synchrony bank credit card login pc richard
Pnc bank check routing number
What is current interest rate for 30 year fixed mortgage
Synchrony bank credit card login pc richard
Does it cost to refinance a mortgage

Progressive Leasing on the Go

Scan the QR code or click a button to download the Progressive Leasing App and get started today.

Our mission is to provide simple and affordable purchase options for credit challenged consumers.

The advertised service is lease-to-own or a rental- or lease-purchase agreement provided by Prog Leasing, LLC, or its affiliates. Acquiring ownership by leasing costs more than the retailer’s cash price. Leasing available on select items at participating locations only. Not available in MN, NJ, VT, WI, WY.

Terms of Use doxo.com" src="data:image/jpg;base64,/9j/4AAQSkZJRgABAQAAAQABAAD/2wBDAAYEBQYFBAYGBQYHBwYIChAKCgkJChQODwwQFxQYGBcUFhYaHSUfGhsjHBYWICwgIyYnKSopGR8tMC0oMCUoKSj/2wBDAQcHBwoIChMKChMoGhYaKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCgoKCj/wAARCAC4AUgDASIAAhEBAxEB/8QAHAAAAQQDAQAAAAAAAAAAAAAAAAIDBQYBBAcI/8QAThAAAQIEAgQICgkDAQQLAAAAAQIDAAQFERIhBhMxUQcUIjNBYXGTFzJTVFVygZGS0RUWGCNilKGx00JS8MEIJbPhJjU2N0NFc3Sy0vH/xAAaAQEAAwEBAQAAAAAAAAAAAAAAAQIDBAUG/8QAMhEAAgECAwcEAAQHAQAAAAAAAAECAxEEEhQTITFRUmHRQZGx8BUyceEFIiOBocHxQv/aAAwDAQACEQMRAD8ApaTMzdWcYTNOIK3FC5UogZndG03T5o1yXpyp9f3pF3ApQAG3pi1r4KdKzNOPy7KE3WVJUl0A5mFI4LdM0TTcyAOMNkFLheBIt2x9FqKXpJHyGlr+sHxNTS3Rdmmsyi6RWZqZLuALS+gtlOLZbPOI53Ripa1ttioawuAYLrUm9779mzpi5aQaHcImkCWE1Rxt0MWwWUlNvdEUrgv02VfEpRub5zPT74zhWilvmrm1TDTcm403b7+pTKtJT1MbbU9NqVjNiErVyTt9sRnG5jy7vxmOhO8FGmDyUpdQlYTsCn727Ia8EGlXmzPeiNliKVt8kc8sJXb3QZQuNzHl3fjMHG5jy7vxmL74INKvNme9EHgg0q82Z70ROoo9SI0eJ6GULjcx5d34zBxuY8u78Zi++CDSrzZnvRB4INKvNme9ENRR6kNHiehlC43MeXd+MwcbmPLu/GYvvgg0q82Z70QeCDSrzZnvRDUUepDR4noZQuNzHl3fjMHG5jy7vxmL74INKvNme9EHgg0q82Z70Q1FHqQ0eJ6GULjcx5d34zBxuY8u78Zi++CDSrzZnvRB4INKvNme9ENRR6kNHiehlC43MeXd+MwcbmPLu/GYvvgg0q82Z70QeCDSrzZnvRDUUepDR4noZQuNzHl3fjMHG5jy7vxmL74INKvNme9EHgg0q82Z70Q1FHqQ0eJ6GULjcx5d34zBxuY8u78Zi++CDSrzZnvRB4INKvNme9ENRR6kNHiehlC43MeXd+MwcbmPLu/GYvvgg0q82Z70QeCDSrzZnvRDUUepDR4noZQuNzHl3fjMHG5jy7vxmL74INKvNme9EHgg0q82Z70Q1FHqQ0eJ6GULjcx5d34zBxuY8u78Zi++CDSrzZnvRB4INKvNme9ENRR6kNHiehlC43MeXd+MwcbmPLu/GYvvgg0q82Z70QeCDSrzZnvRDUUepDR4noZQuNzHl3fjMHG5jy7vxmL74INKvNme9EHgg0q82Z70Q1FHqQ0eJ6GULjcx5d34zBxuY8u78Zi++CDSrzZnvRB4INKvNme9ENRR6kNHiehlC43MeXd+MwcbmPLu/GYvvgg0q82Z70QeCDSrzZnvRDUUepDR4noZVJKUnJunTE03Nufc3JRiUSbRqybj77pSZl4ZX8cxd0cEeljasSGG0q3h0Axlrgl0taViQwyD/wCoImGJoKV5SViXhMR6QZCS1Cmn0IUKgtIVa11mEPUaYbkjMGoLICsJQFm/bFj8FumPkmu8EHgt0x8k13gjbVYS/Fff7k6Svb8jKMh6YZqTKBMPEBxP9Z3wRd2+CfSoTTbzzDRCVBSjrBsBgjkrYii5fytWNaOFrpO8WenmOZR2CHIbY5lHYIcj54+rAJKhcWtGcCvwwtrxB7YVADWBX4YMCvww7BADWBX4YMCvww7BADWBX4YMCvww7BADWBX4YMCvww7BADWBX4YMCvww7BAFP0903puhEjKzVVYm3m5hwtJEshKiCBfPEoZRSPtAaLej613LX8kaX+1H/wBmaN/7xX/wMcMptQpCaczKVGQW4QorW62Ehd8wADkbWN8za4GW2PQoYeE6ak0eTisZUp1XCLSR6A+0Bot6PrXctfyQfaA0W9H1ruWv5I8+Y6MJtZLJUwmVBACljE+bEgdQJKc+gX27XXprR/HMLakX8woNIVcJuUJCSfvLiygo2udvsjbSUuTOfX1uaO/faA0W9H1ruWv5IPtAaLej613LX8kef2arTxSpeVVKJbmG2VpVM8XbcKlly+w2uMOVySR0WELl6lRzS5KWmpFZeZBDjiW0feXdCtosrJItmTtsMO0tJT5MfiFbmvY779oDRb0fWu5a/kg+0Bot6PrXctfyRwRud0eVh4zT3rpQpILQKcRsMJIx7wfYekw2moUZLtPWmQKUtOOLfRgxY7pThF1KOIBQORtkek3MNJT5Ma+t1I7/APaA0W9H1ruWv5IPtAaLej613LX8kefpSco7S51t1h52VcdbU0VNI1uFKuUCoHk3BOSem2Ytnl2aoCmXkokHkL1Sg2sE84SqxIKzYDk5Z9N77YaSlyY19bmj0B9oDRb0fWu5a/kg+0Bot6PrXctfyR5+l56kYpbjcot1pKEJU2hsIKSCjGrGFAruAvxtmKw3jaTUtHkNKS3TV8pL4GNGOxURgNyu5wi+y1uvbDSU+TCx9bqR3f7QGi3o+tdy1/JB9oDRb0fWu5a/kjz7T5ukBqSbqLDq22wQ8hppIKyVKIVrMQVsIFtmULE/RUpY1cgpJTNtOLunFiaTixJuVHbdOVtoOewBpKfJjX1uaO//AGgNFvR9a7lr+SD7QGi3o+tdy1/JHn6dnqQqRmGZOTUhxbTaULUgZLCyVm5USAQQNp3RBRKwdJ+jKv8AiNZeqPT32gNFvR9a7lr+SD7QGi3o+tdy1/JHmGCJ0VIj8Sr9j099oDRb0fWu5a/kg+0Bot6PrXctfyR5hghoqQ/Eq/Y9PfaA0W9H1ruWv5IPtAaLej613LX8keYYIaKkPxKv2PT32gNFvR9a7lr+SD7QGi3o+tdy1/JHmGCGipD8Sr9j1xofwvUHSuvy9Ip8nU25l8KKVPtthAwpKjchZOwbo6PHkTgA/wC9Oleo9/wlR67jgxVKNKeWJ6uBryrU3KfG4h7mV+qYIHuZX6pgjmOwwxzKOwQ5DbHMo7BDkAONeIPbCoS14g9sKgAggggAggggAggggAggggAggggCNmqdJVIobqMnLTbabqSl9pLgByzAIhj6saP+gqV+Tb+USTPOj1T+4hE4HjJTQlioPYTgKQCb26Acr9sSpNcGVcU+KND6saP+gaX+Tb+UH1Y0f9A0v8m38ofUmpqYkFMqZbWE3mEu5knDa2Q6CScrbB0GFH6W1eXESvL+8D/NkTmlzGSPI1vqxo/6Bpf5Nv5QfVjR/wBA0v8AJt/KJSWD4QrjJbK75asEC1hv67w7DNLmMkeRDfVjR/0DS/ybfyg+rGj/AKBpf5Nv5RMwQzS5jJHkQ31Y0f8AQNL/ACbfyg+rGj/oGl/k2/lEzBDNLmMkeRDDRfR8/wDkVK/Jt/KM/VbR/wBBUr8m38ol/wCv2RmGaXMZI8iH+q2j/oKlfk2/lB9VtH/QVK/Jt/KJiCGaXMZI8iH+q2j/AKCpX5Nv5QfVbR/0FSvybfyiYgJhmfMZI8iFOi+j/oKlflG/lCfqvQPQdK/KN/KJkmE4hvEVc5cxkjyIj6r0D0HSvyjfyjQrtCoElSZmYFEpY1aCbiUbH+kWe99hitcIzes0NqdyRhaKvdBSbfEZI8jzRpCEzk86+07LSSFHGhpJCRh9mV4rs3Vnw0WWWVKQm9lpSAo9d9sdt0UkKdX9FqU6pllaUIWF/wBRxi+RuMtsc5qEvISFVckppTimFWabCCk4FZ5G2dtkaSrNO3I6aOGjJXKI5UHUkpQ+/cqB5Ss9keleBaTpFc0TRMTlMkJh9JwqU5LoUeraI8t1z7irTSTlgURa+42j0H/stTinKVPsrVkHDhH6/wCsROTsncxdOKbVhzQlptnhyrDLLaG2WphSGm0gBLY1SskjYPZHeI4VoeLcOdaJ2mdX/wABUd1hN3t+hnFJXsIe5lfqmCB7mV+qYIoXMMcyjsEOQ2xzKOwQ5ADjXiD2xVdOKS/V5inMMScvMAofSVzF8DJUgALuEnlA7NnaItTXiD2wqLwm4SzIrKOZWZVNGpRiVqDiahJPuVoTD548uWUcbRUrB99bDbV4BhvtGzpiBq9Kn2apW6ixJJc1yplpsNyeJ1ZMqnBjJuHGiUkYcNsWHbnHSYjZurBmocTYk5qbeShLjuoCLNJUSElWJQvfCrJNzls2X1hWlmbSM5U1ZJlfqYqE83NMOOz6JhNQYwNIlRqm2kzTZS4heCyjgGI3UQOVcWEIVUa61OyDQbnnAiYDTq1MAIdb4wtvGbNGx1YCycSBmCARcRZhWaWXENipSRWtwtJSH03UsGxSBfbcjKGH9IKe1UBJpfbdeHjhDqLNfeIRZV1Cxu4MtpsbXNgZUnwyhxXHMVWaNcfpdNRPO1Fxx1qTfUhMmk4nS6kuoXhRyAgAEZjarbaw29MHJyV0glqgzTDUG5SWOqaEut0rcWo3UlQBCFIwNnO2ILVbMCLA3pBT3qC3V5d3XyjiUFGqspSlLICUWv4xKgLbzDjNXYu0ieH0dMvLKG5eacbC3Dl4uFRCto2GJztO+XmMqtxILTqXLzUlNIY43MstuFuUdp65pl5RCTZQHNqyASs7MSsjnGu5O6QLm3W21TrZU/gcHFRgYRxptKC2opsu7JcUo3Va1+Tsifn9I6TJSb8yuflXA0F8ht5BWpSRcpSL5q6ol4qqjjFKUfcnKm20yoy05WUVSRbmFzjrJddaWlMvhulLziUuLVqimxQEGwUjeMWICLdBBGU5KXBWLxjb1GGedHqn9xHPNNdNahRNIHpKUQ1qkpSq6hckkXjobPOj1T+4jlnCFo1WKjpO/MyMi48wpCAFpUnoFj0xyYlzUP6fE5sbKpGnele9/Q0vCXWP7GPhg8JdY/sY+GIf6l6Q+jHfiT84PqXpD6Md+JPzjz8+J7+x5W0xnf2/YnGOEWtvuhttuXKiCc7AZC5zOUbCtOdI04cUswMSggXttOwf5uO4xX2dEdJWHA4zTn0LAICgpNxcW3w8rRvSpZQVyL6ihSVJuUG2G9unYLnLZFlPEet/YsquKtvze37Ew/p3pEwoB2XYSSFEbD4ouf2jV8JdY/sY+GNQ6PaVnDenKISClIKGiALWsOqxjS+pmkPox34k/ODniPS/sRKpi/8Azm9iY8JdY/sY+GDwl1j+xj4Yh/qXpD6Md+JPzg+pekPox34k/OK58T39iNpjO/t+x03g60km9IkzxnUoBYKAkpy24vlFyig8FVFqFIRUvpKWUxrS3gxEG9sV9h6xF+j0qDk6ac+J7GFc3STqcQggjCjYRsdBhSrQXyhq9xGSYhgViF7QQgEdMKxCIBkgHaBFb4QmVPaIVNpo4StogncLRYwYrHCMv/orNoJslwYVZ2uN0Vbsrl4LNJI8+6J6SS+glXZkashMxSZzVOKKwDqFkZLA6srxLcLzchKSyquJvjGLm16wKB3BIEU7TZyRW8sT7ag882lbCegNgWGcUScU27TDLyoWW0vJ2qJSm4OwdF8P6Rvsc8FUbNY1XTm4o05zHNKVMLNyuxUe0x3n/ZsmhKViZp6ikAtlzlZG5tmN4+UcXXIK+iFvA8lKQbb8kx0ngkpdQ0gqLE8gKYkpVji6n7EYjst12vGc5brDL6nT6HJcX4YXnicQfmHXEnZYalQI9hBjsMc9aoL7GntIqbLmukyhbazblIVqiLntNzfeY6FE33I53xEPcyv1TBA9zK/VMEAYY5lHYIchtjmUdghyAHGvEHthUJa8Qe2FQARFTFNmhVnJ6nzjTBfbQ2+h1guYggqIKSFJwqsojO42ZZZysESpOPAhq5VXdEErMsUzeTYWhxCkuBLiVOlzYhxOdyduIHdCvqqszbThnkallZU2gMWVYzLb5ClYs80Yb2G2/baIhRQEpddLdQn2mlg4W2ncIQpSiVKFsjtFrjK3u028+ZXZx5CW6EsaNS9JcmgTLBrUPIaw4S0pKmypJJuQUJvmL57I1qnQKjUywZyroAbWlZQywttBwrSoZB3M8m3KxDPICNw0BF04KjVG0pFglEyQPd/nuiSkWFS0slpby3lAqONZuTckgey9vZEKrJO6DhF7iuzuia3qfxZidbbKmH5daly+O6XV4yQMQsQRtzvFpggiJTlLiSoqPAIIIIoWGGedHqn9xGhPzcyxNOBuZp6W0hJwPKOMDpNh+kb7POj1T+4iPmyXJyYQ3JSr7gwHlFGJYyxA53FgRtHSIATNTk4hklM1TEKHJONRFlCwV7iT0dIjLM3Np1gemqYVITcgLIwklNr7hmR7U7YwsuLCQumSyVOKxhKloVjNs92eSc8/0gCZhbr6RSpVKSCFHElWJViRfZuRADLFWedaSsTlLABAWolaRfqBh1U5NNuzGKbkDY/dpKrBKSoYSo78JPT74SyDMLIRSpNSBiu6ChV1AEDIbL5dJ6R1w4njBQ6HqQwt0YMRCkhLmdri46AL2PVADYqE4i4fmaUgpUEq5ZO7Pbl07d0Otzz95dKpumrWV2cCFEkgkYQkX22PT1Q2suqsmYpMs48sg4MST/Tck3G8Ee6FLS8gocRSZZK8WSSpGI4QLWO+17dSYAbTU5lYZIeksD18JbC1q2DdcXuRthCqhOKDiROU1CwS2cWJOFQuCc+sHqyiRk2GAxZ2TZl1Egqa5KgDkBa3qj3RscVlXCV6hhRXmVYAcXtgAlZhp4FDbzby0AYygg557uww+Yal2WGhil220BQGaEgXHRsh0wAkmEqzEZIhJuBEATYWguCIZm1PCWc4sEF7DyAvxSeuOSVThfnKDU3JGvaOqYdbNrtvXChvFwMolRcuBDdjrLqlIVmModSsavF1RzvQnhVpmllTdkuKuSa0pBSX1p5aiTcCx6hHQwRsw2iGrOzBlpeJJMQulEmmrUeYliSAReJsLGwQ2vAtKk225GKSV1YtF5WmeOeFppuWmmJWYsgSMulkupHKUSSQAN9rRTkTUrKTCZOT1imnWUl4LGaFeMCesElPYY6Dw4ywmdOJrjRQWEgJYQ2oEur2AEbR/wAo5tPKlWq5OIbuGmnC44rCCFqHiptstiv7Lx6NOn/TUWUcv57o62zovxjQ6VbYRd6aUUdljY/rf3R2FiXldGdDpOnSSAlTTIJwjp6Se0xF8FdMbVwf0ZRSrXEEqx7b3Nx2XvEvpiDL0hwrFirbvMeU005HZmUsqNzQGouTTpS4doi9xy7gyeC59Cd6T+0dRjWH5TGqrSEPcyv1TBA9zK/VMEXMzDHMo7BDkNscyjsEOQA414g9sKhLXiD2wqACCCCACCCCACCCCACCCCACCCCAGGedHqn9xEVVpJT84VopaHjiT96X8BIsQcgbi2z2xKs86PVP7iK5pLpZJ0OoMy0/U5OSXMLW3LtOy63FulDYcWRZQ2BQ6N2+AHDJuIdmGU0YatRwIWHyLotliz3gnaOiHhKONBtJpSSwVoc1aXiS2vYSc7EZ9A6I1JTSZE0gmXqki48EKcEuZVaFqASVG11noBzFx2xFaV6VaQUWqOsNMUQsE3YDrr2tWmyjchKCP6T7wOmLwg5uyKykoq7LHMyF9ctFK1ix92m8yRjSbi+3Kw/5QluR1bRSqkpK3CUkJfPi3BGfR2dXsit6NaXV2p1yUk5hqhhp3GVhl17WBKSUnJSAAbhVgbHkq2WiDmeErShNUel2NHWVSwfW22/ZxQKUqKcRt6py6oirHYq9R2NKEJYhtUlf73L8ZFTa0PNUZJccKw4njNsAJ27swpRyjP0fZof7nClLLpWBM2te3TfO/wCluuIvR3SStTukDUlUZCXbk3GlqS+2FJONNsrEkEZnZujce0ylZeZcYmZScYcSnENahKAsXAum6swLi56Ixp1oVYKpB3T+/qHGSlla3myZHWupUujBJulJVxnYlKsrAHqBjfVRpBSUJVLghKcIGJWQ3bYiprSgJoFYn2ZR9tySlHJlCJlGAO4Uk5Z3IyGfXHO5bhWr01TVT0tT6S4w23rHSHHDq8iSlW42EdNOjKorxOariIUmoy4s7My0hlpDTYIQgWSCSbD2wsxQuCnTiY00Yqq5qXlmTJPJbSphSilwEHPPsi6vqOE2MUnBweWRpTqRqxUo8GOmEq2REOlw3wrF90NoTNOEpbII6T0CM7muUlleKYq3CDodT9LqQWJkJanEj7mYAzQdx3jqjfncMkjHPVGXl0jpWq37mG0aXaOMthDlbkbpyup0CLK/FFXY8117QKfpTaghLrM8hARdKzk4m+YP9qxmD0bI6BwKcLIn1taO6VOaupN/dszDhtrLf0q/F19MX+v1jResSq5dNSkJqZdGBpDb6MZJOwZ7bx5y4XNCpyTnm6rT2lIedTrC2k8onptbp7IOe+0/U3UFUheC3r/J7DCRfK0MzZLUs84kC6UFQ9gjjPAnps6/TKcnSF2YTMuSykrdfuASlzAnb0kW98dBndN9GJlp6Ubr0ol9YLYCHBjB2WA3xWN2zOpHJY876fSrhqFT0iQsqclyk6vaNYsDL3Xv7I5tSKIicnKTKzKlINVmStVturByses3jonCZMs8QnAlxSZaYnMJWi5xCwFgN1geuIrQaQE/wo0mTcWkMybAduMwsgXsD08pQN9wj1a26m3yRlTjv3no7RaWMs7IyTZOqZRmek2G09sR3CLNpXLrbB6Yn6EAipPZ+K0T+sc+05nEmbdST0x4jdonXBXmSnBUr/e7afwq/aOvxx3gfTrq08sXwtNE36yQB/rHYo1p/lM6v5hD3Mr9UwQPcyv1TBFzIwxzKOwQ5DbHMo7BDkAONeIPbCohJioU5M+uWenFNTCcOJOtWhIxXwi9wLm37bxDa6jSkOISqonlo1iV8ZXgKcWG+K9vGsNu0gdMAT8EQap2lJBxVRsW23nTlnb+7flDqXZFb6mET2J5JwqbE2oqByyIxXvmPeIAl4IiWVSr7q22n5lS0KKVDWOZEbc7w0zNU95tC0Tq8K1YRd9Yz9p6oAm4Ihi/IAAidWoEAgpmFqyJCRsO8gQpTskla0LnFoUk4SFzC055bz1j3wBLwRFnigDRM2oB0XbJmlcvZs5We0e+Gw/IHDaeNlAkHjSrG1unF1iAJiCIkOSRvadUQACTxlVs79OLqhxhMs/i1Ey45hyOCZUbe4wBts86PVP7iNKdo7M3Ma15mTesvWI4zLB0oUUhBKTcWuBb3xsrZStISSsW6UrKT7wYRxVHlJjv1/OANZ2iodmnJlaZNMw62ppbyJcpWpJABzxZmwyJvb3xrVXRoVKdMw9POXAKUJMuyrAklJIBUgm10pPsiS4qjykx36/nBxVHlJjv1/OKyjm5/wBm18Foyy/8T+SGpWh0rTagzOMv3daJIPFWEk3BuMQQD/UenpitTHBDTnqk/OprFTQt15TxSCjCCok2th2ZxfuKo8pMd+v5wcVR5SY79fzhkTWWW9d9/wA3LwrTg80HZ8N274ISiaHt0utN1H6Rm31NtKaS0vCEDFa6she+Q6Yn35VS2ylp4tKP9QSCR74b4qjykx36/nBxVHlJjv1/OIhThTgqcFZLluM3Jt5nxIb6otLYq6JqoTkwupSq5RxxwpuhKgQcIAsNvZFUkuBunSVOmpGXrFREvM86Clsk5W24esx0TiqPKTHfr+cHFUeUmO/X840ot0I5Ke5cSlaEa8s9RXfArvB7oJI6Cys6zTpqZmRNLStRfw5YQQLWA3xYJpxQ2CFcUR5R/vl/OEKkGVeMXT2ur+cJyc3eXEU4xprLFbjRUpy/i/rHNtP9PKno3T6uuTwhbJDbKVpvYmwv7zeOq/Rst/a53ivnDExQabMgiYlUOgm9nCVfuYrFJM0cro8+VDSOZ0LoyWlPF/SRcumcmZqZ5aklYJwIB8UC2fXFDRwtaROqKqjNpn5dZzZmGkLQerCRHrya0bpE26XJqRZfcIsVODESN1zGv9T9Hrf9USfdiOlVYpJJHPs3d3Z5Zk9MNFp15KpuiIp0xivr5HkAH1DyfdaLvWarTq8xK/QsyytxIBAIS0UrtndPSD1b47f9TtHhso8l3QhaNFKEjxKXKp7EWjOcozVmjanKVJ3izzTK1ucfqsrS6mAuTuuWdbAuFJcFikxO8HvB8vSOcekNOaRPtzcmkIVPNvBKZgXyJyOI2yuDffvjvydG6QhwOIkWUrBuFAWN+2NwU9hJunWg7w6r5xhCLjuRvVrbSzseW9OdCqhKS6JdUlNKl25slWRUkMoHJ6Msv1iN4MZGbmNO351sTTJRcAYbGx2ggjPJI2WMeuDJtnap7vl/OEpkGEqJTrQSbkh1Wf6x11MQ5wcGjFbisaPNLSzNTrl7FOFJNx2xxXTicdNVfxjCMRtuMekjIslOEl3Du1q/nGm7o9SnT97Jtr9a5jidO5rGrlbdjnHAMLSM68sEKmHQlJPSEgnL4o67GhJUmRkVBUpLpaI2Yb290b8aJWRlJ3dxD3Mr9UwQPcyv1TBEkGGOZR2CHIbY5lHYIcgDTcp8g9MOOOykq4+qxWpTSSo9AubX6P0jCqXTlIS2qRlChAslJZTZIuTkLZZ3jQm5Rl+pvKepylXtZ7WK5ZCR0DZtt7DDLeo1VnKPNpwNKQpKcSuSq90jMXzJ/SAJT6JpxKj9Hyl1Jwk6lOYvits2Xz7YdTISiXy8mVlw8SVFwNjESbXN7dQ90Q5TKrc1v0VOXbLaQVhVyL2uACb2CE9ey8YEvJNrmWDSZuy7tqUjEQtNx/USN0ATbaJZwpdbSys5kLSAdpzz7YxxKV82Y7sRGJRLsuJcRTpo4AkNlOLEArM5Ei2ajfMnbGvKMytlLbpD7WRb+8Cs0qBByzOwAe0ZwBNKkZPV4FSsvq8OrwlsWw3vhtuv0QpcrLLcuthlSz0lAJ/zZEI2xJLUoIpM0khsu4nAoYlbcNwTndR9o6coypVPQ6lhNMnCrEpSbIIvmm6sze1wn3QBMmSlSWzxdr7u+AYBZN7HIewRgyUopJSZZgjpGrEQc7LSCl3+i59ZSnW8hBAUVDYTe9xuGww6pmTlphBbpM0osqBCkgkA2vdIvnsH+CAJYS0mpa0hmXK02CgEJuMsr+yHm2W2r6ptCL2BwpAvbZEE4xJtSoApk9qlErUhIKlEjELEX68rbxGENSmodaFKnkoWpJVySbhKstpv0A2HQYAsC1JQklagkDpJtCorbMrT3lBs0icbbVYXUlQGdhnY5AZfr2kWJRTSWU0ad1KlFw3SUkKsRfbfO/6mALJGMQ3jbaIB1iUIKzSptQcQVKGd/GPJIvvz9ogW1JNoS0mlTim1pDygEqyNlEDb42ZFusQBPkgbTaDEMRTcYgLkdNv8BiFdak3X9Sumzagt4qUuxw4lAXJN9nyjXlGJOXLzyqbONnVrdJULgDDYpGe218v1gCxxhSgkXUQBcDOK3JiSknkFimVJLiQrAMPR7+wZ9V4yZSmqxoVSpoFpKVhIvdQIAGxW3/6ndAFiQpK0hSFBSTmCDcGMFxCSQVpBABIJ2A7Ir5lpZt9hf0VNglJvq7qHKGGyrnco9loU5KyCm0KXSZw3BOFIOWaz/d05/EIAsCVBQukgi5GW8RmK5q5B5shFMncBdDh5JAUcKhe972tf3iBmUp5bUVUqcOFP9STcgqthGedv2zgCwlSRtUBmBmek7IEqSsHCoKsbGxvY7or6kyS2Q0aPP6snEBgIzAVb+rt94gmZWSQ20tFJmHEqJCk8rEixA2dO02gCw3F7Xz3RhCkrTiQoKTvBvEE4JZhLeGmTrqmOW2QjpPKtkfxEbMrGG0syCMCkUifBGSbIPQR+L99toAsSlBKSpRASBck7BCVuIbF1rSkdZt0XivKlpBptYTR55WJIJFib5ZC+L8I94jYDUoHlMKps1yk6grAUpJQOQM77ldtrnrgCZS4ha1JStKlJ8YA3I7YViGIJuMRFwOn/ADOK42xIrF1UacxKAQoFJI39KtlwM+yFzfEHpnC5Tp19xhsC6QokAjEB423bt6coAsFxe184Li9r57ohEplGENrRTJ0FtxSkgJJIIAz8bpyt2GEqk5BCXECmTNly9yAFZpuORkclZA2gCbccQ0grdWlCBtUo2AgQ4hYuhaVC9rg3zivzIklghVInHCm2JGE5BVjsBtfIRsStKp0yXSqQcawKwAOFQxC20Z2tmYAmcScWG4xWva+doVGvLybEu886y2EuOm61XJvGxACHuZX6pgge5lfqmCAMMcyjsEOQ2xzKOwQ5AGjMS02txxTE9qUqzCdUFWySOk9R3eNCFyk6qXCBUlBeK5c1KbkW2WFu2NtRzMULR7T2YqzlMTMUlunpnyS05NTSkIcSA1k2VNgrWS6QE2AOBRCiIlOzuQ1dWLmiVnQ6FLqOJAxcnUpG0G2fVce6EsSc+3qwupFxKSLgsp5QyyvfqPvilv8ACQ1KVmoyc5TXEsyjy2w627iU4lDby1KCSkD/AMG2RIGMXIjM5woUun8eVPyc22zL2UhbSm3Q6nVNuEiy7XGtGwkG1wTna2d/UiuRfWy6olZ3E2XKgVJSvEpIaCcQvcDLZll1wliTnm1t46kXG0kXSWU3ULbCf9YraNO5V2uyFLakZtLk3NOy4ceUhKbNl1KlpAUSoYmlC1hYWJtcXxTNOWKjK6Rrl5dJmKPrCWVPYA4lOLCVLUAlGLAd+HpzyihcsrcrUEtgLqIcWSLq1KUgZm9h1iwgTJz4vepqJy2sJ3H5j3RTZXhNprrTYMnNuTCm214JfCpJK3ENgJKygkXcTyiAk2VYm0byNO5GZpVUnJGXfcMg2y4pLpSgKDoulVwVWSBcqJGQByNosptKxVxT3lmdlZ0hsNVDAEowqJZSoqOeefs90ZVLTmrdCZ27ilAoUWxyE4gSLbDllnnFT8IMg1MMS8xKzK1uzKJRL0oUvsLcUhC+Qu4KkgOIzwgnOwNjGjTOE1io1GnMS9Me1E7MiXS6qYbBQChKgpQva91AYQontOUTnf1IZEXZMpUb8upZA5WZTmOvdDjMrOIW2pdQLgB5QLSRiG7LZFTqHCBJUtc+qoshDMrNcVCGnguYJsTjU0QMKCEkg4iSM7Q7T9OpWoaQydJYkZttyYK/vH1ISMKdbykgKJVctKGwWuOnKDm3/wARGRfWy6jZntjMcxa4S3kpSqcoD7aVNPPDVPa26UpWWtibAuFpxISSDcDI3ytuilc+n6c7M6ppGreUziYe1zTlrcpC7DEM7XsMwR0RQuWGCGIIAfghiCAH4IYggB+CGIIAfghiCAH4IYggB+CGIIAfghiCAH4IYggB+CGIIAfghiCAH4IZTth6AEPcyv1TBA9zK/VMEAYY5lHYIchtjmUdghyAEhoqF7iM6g7xDrXiD2xDT7upTKFyq6p0Nc4GiUuG1iuwOG3T02yi0Y5nYrKWVXJTUHeINQd4iNyfRqlVpC1YgQWylKr2Vlkcxsy/CfZk2D+saqyRgSCtsHGMIFzYEk5g9fRFtn3+SufsSOoO8Qag7xESFLbIS7Xm8LagFJUhKVcki4JvfoOfXDikrOIIrKEuNqW5ewNkKAIBBNiBcWO4iJ2ff58DadvgktQd4g1B3iI8r+5KnKwypIwkL5KQDZW0gjbtt+HpzhttSnJpu1cQrCu2rwJSVcrIdeQtsiNn3+fA2nb4JTUHeINQd4iFW8p2WU6xWFtMEhGLi5PKJNszn0jZbYNkPPOB17WpraGgleIJskJw28U3OeQOfR7InZd/8PwRtO3wSmoO8Qag7xEY4tbuIIrHJDRPJaBvhyUq46+gQptwu4UorLalnCUgJQDtucusEC0Rs+/z4J2nb4JHUH+6EtyiWwQ2EpBJUbC1ydpiKDq2pdA+mkIwoxFTiAVKzBvhVna27fG5T5ltDOKYnEvLWApS9iEnxbA7BmD2wdNpX8hVE3Y29Qd4g1B3iEoqEmtOJM0yU4sIOMWJtewPTkYyZ6UF7zTAttu4IrlfIvmXMzqDvEGoO8QpiYamAosrCwLXIGWYuM+ww7FWrcSb3GNQd4g1B3iH4IAY1B3iDUHeIfggBjUHeINQd4h+CAGNQd4g1B3iH4IAY1B3iDUHeIfggBjUHeINQd4h+CAGNQd4g1B3iH4IAY1B3iDUHeIfggBjUHeINQd4h+CANctFGZMKhb3ie2EQAh7mV+qYIHuZX6pggDDHMo7BDkNscyjsEOQA414g9sRzjThZlyimy5wNABpeEaskC6QcwBkBkLRIteIPbGi/S0PBgrmZkONIwB1KgFnK1ybbey0Wg0nvKyV1uG8LqHkJbpLAQSklYWkYbjPK20XUP/2GkCZTMKAo8ulom2LGi5Tsv7icvZGwqktONFt96ZeRiCwHHL2OeY9/6CMmlNa9LyXXm3EhIughNwNgsBs27N8a54/b+TPLL7bwazzDi3VumkMLcQ6cJxp+8Sb8rtyTtvthUqp90LdNJaZVbCm6hiNiBbZsy/aHG6OhGACcnShJSQgvXTlbK1tmQjKqQ2RYTM0kha3EqSsApx7QDbZfOGePDz5GWXHx4GClxtAtRmilyy1p1iThX4uy262Y3nrhTiH25i7FIl8KF8leNIKhvGWUbH0YgowqmJlYyIxrCrEXzzH4v0G6ECkI17bpm5xRQSQFO3HjX/0A7IZ4/b+Rll9t4G1om1M/d0+VbUVYVpUQu6QLC1rdgB6N0NusTCXXEJpco4yAFNGyU2VYXuM+ndD71HbdSpImpttCgQUtuBIN75mwzOe07crwp+lNvPh1UxNBYXjSUu2w7wOqCnFfX5Di39/YZaS+XUg0dhpIUE48aDZJ8YgAdZhDaJlDUusUiW1hF3EAoSUqByIOeXTv2bI3TTwcjNTlrIFtcf6QRt253z32EMOUVDhJVOTxJAF9buJIOzbnBTj9v5DjL7bwJWy4tCgaVLixIwnCoLFgeq1yOvYMt2GkPuvIbepEs3L7CSpKrDM7t9ujphyZpSnnsaahOtiwBSlzL+n/AEB9pvEgw0hhpLbYslMQ5pLd/vySoNvf/oh0tzGrwmjSxUnlhV0AYyLEhOf75gQ4pteuWRRWDgJwLxo5Vr2OzLo98S8EV2nb58k7Pv8AHgj5V2aDiEfRyWGSqyiHEmww7bDrsOyGmZmrAr10i0oBQSMLgTferacurbl15SsERnXL5JyPmaHGp8S+M04F25+7D6dmVs7dvugXNTjbSVqkrqUUJwJXcpJUQTfcBhOzpjfghmXL5JyvmRxmaiG21cQQVG+JGuHJ2Wz6en3Q5IPTj1jNS6WAMSSL3JIIsR1HPLszjdgg5K1rBRd+IQQQRQsEEEEAEEEEAEEEEAEEEEAEEEEAEEEEAIe8T2wiFveJ7YRACHuZX6pgge5lfqmCAMMcyjsEOQQQA414g9sRDOkUq6tpAZmUqcw5KSBhv0nPIDpMEEdFCnGad/QwrVHBqw+xWGXlSwQ08A+lKkqISAMWKwJvt5JyhDddllpxat8WtcFIvmbDK9ztBy6O2CCNNjG7RntpWTGWdJJJ50IQh+5JFykAZEjfnsuLbQRG07WJVtClctQQ8phQAHJUN+eQ6zvEEEWnh4KVkVhXm43Y0xXpV5VkoeBwKczSNgBO/qMJVpBKpDmJt4YPVz5QTcHFYi529RgghsIZrDbztceXWWG5VT623UtpF88IJGALyz3EZbYaY0glH0Y223ymylC6QLhKcVwL9IggiI0IOLZZ1pKVjDekMmtxaAh66HNUrkjkqvbfs64mIIIyr0402rGlCo5p3CCCCOc3CCCCACCCCACCCCACCCCACCCCACCCCACCCCACCCCACCCCACCCCACCCCAEPeJ7YRBBACHuZX6pggggD//Z">

Источник: https://avalonstudios.ca/v/pc-richards-pay-bill.html
FAQs

Synchrony and P.C. Richard & Son Extend Strategic Financial Services Partnership

STAMFORD, Conn., March 28, 2019 /PRNewswire/ -- Synchrony (NYSE: SYF), a premier consumer financial services company, today announced it has extended an exclusive multi-year consumer financing program for P.C. Richard & Son, a leading family-owned and operated appliance and electronics company. The partnership provides financing options for consumers at 66 P.C. Richard & Both ernest hemingway and f scott fitzgerald were locations and www.pcrichard.com.   

Since 1986, Synchrony has offered P.C. Richard & Son customers a branded store credit card and promotional financing options for all major purchases on appliances, electronics, and mattresses. The partnership also includes marketing analytics and mobile technologies to help enhance the customer experience.  Specifically, the two companies have partnered on marketing and loyalty programs and a branded mobile app for purchasing and payments. The experience allows customers to shop online, receive special offers and promotions, and service their credit card on the P.C. Richard & Son mobile app.

"P.C. Richard & Son is famous for their customer service and values the shopping experience from start to finish," said Neeraj Mehta, chief executive officer, Payment Solutions, Synchrony.  "We look forward to continuing to work with the entire P.C. Richard & Son team, helping them grow their business by delivering new capabilities to create compelling customer experiences."

The company's 110 year history and deep customer service focus was featured on a new Synchrony podcast series – "Business Schooled" – where Gregg Richard, Synchrony bank credit card login pc richard and synchrony bank credit card login pc richard of P.C. Richard & Son, discussed making bold decisions and leading a new growth strategy for the family-owned business.

"Synchrony has been an important, strategic partner in helping us develop innovative payment experiences for our customers for more than three decades," said Gregg Richard, CEO and president of P.C. Richard & Son. "Our customers value the convenience of a dedicated line of credit for their purchases, and we are pleased to continue to provide payment options through the renewal and extension of this successful credit card program."  

About Synchrony bank credit card login pc richard (NYSE: SYF) is a premier consumer financial services company delivering customized financing programs across key industries including retail, health, auto, travel and home, along with award-winning consumer banking products. With more synchrony bank credit card login pc richard $140 billion in sales financed and 80.3 million active accounts, Synchrony brings deep synchrony bank credit card login pc richard expertise, actionable data insights, innovative solutions and differentiated digital experiences to improve the success of every business we serve and the quality of each life we touch. More information can be found at www.synchrony.com and through Twitter: @Synchrony.

About P.C. Richard & Son

P.C. Richard & Son began as a small hardware store in Bensonhurst, Brooklyn in 1909, founded by Dutch immigrant, Peter Christian Richard. It was transformed by his son, A.J., into what is now America's largest family-owned and operated appliance and electronics retailer with 66 showrooms serving New York, New Jersey, Connecticut and Pennsylvania. P.C. Richard & Son is headquartered in Farmingdale, Long Island, New York, where it also houses its main distribution center. The company has over 1 million square feet of warehousing in New York, New Jersey, and Connecticut, plus 3 owned-and-operated, state-of-the-art synchrony bank credit card login pc richard facilities for repairs on appliances and electronics. Customers can find a large selection and guaranteed lowest prices on a variety of products at P.C. Richard & Son, including major appliances, televisions, mattresses, computers, smart home products, home audio, video games, and more!  All of P.C. Richard & Son's nearly 3,000 employees are dedicated to providing Superior Service Before, During and After the Sale, and giving customers a wonderful and rewarding shopping experience. It starts with friendly and knowledgeable salespeople, who explain all the features of today's high-tech products, then continues with next day delivery and professional installation and repair service by their very own crews. An expanded catalog of products can be found on their e-commerce site, pcrichard.com, where live chat, e-mail, and a toll-free phone number are readily available for customer support. The company is currently run by the 4th and 5th generations of the Richard family. P.C. Richard & Son is built on a nearly 110 years of honesty, integrity and reliability. Richard IS Reliable!

Synchrony Contact
India Kessler
203-585-2136
[email protected]

Cision View original content to download multimedia:http://www.prnewswire.com/news-releases/synchrony-and-pc-richard--son-extend-strategic-financial-services-partnership-300818708.html

SOURCE Synchrony

Markets Insider and Business Insider Editorial Teams were not involved in the creation of this post.

SHARE THIS POST

Источник: https://markets.businessinsider.com/news/stocks/synchrony-and-p-c-richard-son-extend-strategic-financial-services-partnership-1028066927
Espańol
  • You know
    what you need.

    We’ll help you get it.

    Shop at your favorite stores and enjoy convenient

    Apply now

    lease-to-own purchase options.

    No credit needed.*

As easy as 1-2-3. No credit needed.*

Apply for your lease

Once approved, go shopping at your favorite stores

Take your items home

Take your merchandise home same day or arrange for delivery

Simple, automatic payments

Schedule your payments around your paydays

Shop at your favorite stores with Progressive Leasing

With thousands of retail locations nationwide, you can enjoy convenient, flexible lease-to-own purchase options on items such as furniture, electronics, jewelry, tires edd unemployment login ca wheels, mobile devices, appliances, mattresses and more…

Find a store

No credit needed*

We know a three-digit number doesn’t tell your story. That’s why every Progressive Leasing approval is NO CREDIT NEEDED.

Our underwriting process allows us to consider everyone with less-than-perfect credit. We look at many other data points including income and banking history and regularly approve people with less than perfect credit or very synchrony bank credit card login pc richard credit history.

*Progressive Leasing obtains information from credit bureaus. Not all applicants are approved.

Convenient, automatic payment options

Get paid weekly, every other week, or monthly? Easy payment options and automatic withdrawals accommodate your payday schedule.

Thousands of retail locations

Furniture, electronics and appliances – just to name a few.

Find out more

Take it from those that know best

  • "Thank you for giving INCREDIBLE customer service!"

    Derrek

    Brooklyn, NY

    synchrony bank credit card login pc richard

    Synchrony bank credit card login pc richard -

    Does PC Richards repair?

    When to Repair or Replace a Washing Machine Get an estimate from a professional to see if the machine is repairable and how much the repairs cost. At P.C. Richard & Son, we offer a wide range of washers for you to explore.

    Does PC Richards install washing machines?

    Level the washing machine on solid floor. If an optional pedestal was ordered for your new washing machine, we will install it at no additional charge. If you have any questions regarding installation, please contact one of our customer service representatives at (631) 773-4900 or (877) 727-1909.

    How do I pay my PC Richard bill?

    P.C. Richard & Son offers four convenient ways to pay your P.C. Richard & Son Credit Card bill.

    1. Pay Online: Visit the Synchrony website to manage your account and make payments online.
    2. Pay In-Store: Bring your P.C. Richard & Son Credit Card statement into a P.C. Richard & Son location and pay your bill by cash or check.

    Is it hard to get a PC Richards credit card?

    Pc Richards Credit Card is a great Credit Card if you have fair credit (or above). Their APR is quite high (above 20%). If you’re looking to apply, we recommend at least a 630 credit score. If you’re not sure what your Credit Score is, apply for a report, here.

    How do I pay my synchrony bank bill?

    Over thousands of locations. Everything for your home — from floors to décor. Get help and support for all things Synchrony….On the mysynchrony.com log in page, tap the Pay Without Log In button and then:

    1. Select your payment amount.
    2. Select your payment method.
    3. Review and authorize your payment.

    Where can I use PC Richards credit card?

    Available for online and in-store purchases at 66 locations, the P.C. Richard & Son Credit Card can be used for thousands of appliance and electronics products, as well as mattresses and bedding.

    Does PC Richards accept PayPal?

    No, P.C. Richard & Son does not accept PayPal.

    Does PC Richards take Apple pay?

    No, P.C. Richard & Son does not accept Apple Pay.

    Can I pay synchrony bank with debit card?

    How can I pay my Synchrony Bank bill? You can pay them directly on this website. Or pay on doxo with credit card, debit card, Apple Pay or bank account.

    Источник: https://answerstoall.com/users-questions/does-pc-richards-repair/

  • "I had a great experience from the start. I'll definitely use Progressive again."

    Carlos

    Draper, UT

    Subscribe to Overdraft Apps

    One of the benefits of the P.C. Richard & Son Credit Card is that you can get 0% financing for 6 months or more on various electronic goods, appliances, and mattresses. If you’ve arrived here after Googling “PC Richards credit card Synchrony Bank”, you’ll probably already know this and are looking for how to apply, how likely you are to be accepted, and in which locations you can use this credit card. Find out in this article below.

    Credit score for PC Richards card

    It’s a good idea to have an inkling of whether you’re likely to be accepted or rejected for this card before you apply. This is because applying for credit will lead to the lender making a hard inquiry, which can result in a temporary drop to your credit score overall.

    Synchrony Bank backs the P.C. Richard & Son Credit Card. You’ll likely need to have a good credit score of 700 or above to be accepted. With that said, some people have reported that they’ve been approved for a Synchrony Bank credit card with a fair credit score in the 600s, according to Credit Donkey.

    To boost your chances of being accepted, it’s best to get your ducks in a row before you apply. Check your credit report and make sure it’s free from errors and that there aren’t any late payments marked on there. Of course, the higher the score you have, the better.

    More on Luxury Synchrony bank

    How to apply

    You can apply online for a P.C. Richard & Son Credit Card, or at any of their physical store locations in the U.S. If you apply in store and are approved, you can begin using the card the same day.

    When applying, you’ll need to provide your personal information, such as your name, address, social security number, email address, phone number, date of birth, income details and whether you rent or own your home. If you apply in store, it’s worth taking some identification with you just in case.

    PC Richards locations

    There are 66 P.C. Richard & Son locations, mostly in New York but also in New Jersey, Connecticut and Pennsylvania as follows:

    • New York – you’ll find stores in the Bronx, Brooklyn, Manhattan, Nassau, Queens, Rockland, Suffolk, Staten Island, and
    • New Jersey – there are several stores throughout Northern, Central and Southern Jersey.
    • Connecticut – there’s one store in New Haven County and three stores in both Fairfield County and Hartford County.
    • Pennsylvania – there’s only one store to speak of, and you’ll find it in Northeast Pennsylvania.

    If you don’t live near a store, you can use the P.C. Richard & Son Credit Card to shop online. Some of the products at P.C. Richard & Son are available for free shipping.

    Fees and interest rates

    There’s no annual fee associated with the P.C. Richard & Son Credit Card and the interest-free financing is excellent news if you want to spread out the cost of a purchase.

    However, bear in mind that if you don’t manage to pay for your purchase in full when the promotional period ends, you’ll have to pay the regular interest rate which is 26.99% APR. The same rate applies if you want to buy something that isn’t available for special financing. That’s a pretty high interest rate, so consider how long it will take you to pay off your purchase before you apply for (and use) this card.

    You may be financially better off applying for a different credit card, with a 0% APR introductory offer and a lower interest rate afterwards. For example, the Chase Freedom Unlimited® credit card offers 0% APR on purchases for 15 months and then rolls over to a regular APR of 16.74% – 25.49% variable. What’s more, this credit card has no annual fee, and you’ll get a $150 bonus if you spend more than $500 within the first 3 months of opening an account.

    More on Best credit cards with 0 balance transfer fee

    Summary

    This credit card might be for you if you tend to shop at P.C. Richard & Son frequently and want to take advantage of the special financing deals they have available. As the regular interest rate associated with this card is relatively high, you may find another credit card deal more suitable for you, providing your credit score allows you to explore other options.

    *The information presented above is correct at the time of publishing. We hope you find this article useful, but please note that it doesn’t represent professional financial advice.

    More on Discover It credit card application

    Источник: https://overdraftapps.com/pc-richards-credit-card-synchrony-bank/

    Synchrony Bank credit cards

    With most traditional credit cards, the name of the issuing bank is obvious from the get-go: the Chase Sapphire Preferred Card, the Capital One Venture Rewards Credit Card, the Bank of America® Premium Rewards® credit card, and so on.

    But with store credit cards, the issuer name takes a back seat to the store itself. Unless the card is already in your wallet, you probably don’t know which financial institution issues the Victoria’s Secret Angel credit card, for instance. (Spoiler alert: The answer is Comenity Bank.)

    Another under-the-radar name in the retail credit card space is Synchrony Bank. Keep reading to learn more about the store cards it issues – and whether one of them could be right for you.

    What is Synchrony Bank?

    If you’ve ever held a private-label credit card – also known as a retail card – there’s a good chance it was issued by Synchrony Bank, a consumer financial services company and the largest issuer of such cards in the U.S.

    Retail credit cards are largely similar to general-purpose credit cards, with one major difference: In most cases, they’re branded for a specific retailer, independent dealer or manufacturer. (That said, some closed-loop retail cards, such as the Old Navy Credit Card, also work at affiliated brands, including Athleta and Banana Republic. There are also open-loop store cards, such as the Capital One Walmart Rewards® Mastercard®, that can be used anywhere the payment network is accepted.)

    Store cards like those offered by Synchrony are usually easier to qualify for than general-purpose cards, making them a good choice for people who are either new to credit or recovering from a credit stumble.

    What stores partner with Synchrony Bank?

    Synchrony partners with stores of all sizes and industries – from national clothing chains to local furniture shops – to offer credit cards or other financing programs to customers.

    Here’s a list of Synchrony Bank credit cards that, to the best of our knowledge, are currently open to new applicants:

    • 1800Mattress Credit Card
    • 4WP Credit Card
    • AAMCO Synchrony Car Care Credit Card
    • ABC Warehouse Credit Card
    • Abt Credit Card
    • Adorama Edge Credit Card
    • American Eagle Outfitters Connected Visa Credit Card
    • Alto Music Credit Card
    • Amazon Credit Builder
    • Amazon.com Store Card / Amazon Prime Store Card
    • American Signature Furniture Credit Card
    • American Tire Depot Credit Card
    • America’s Tire Credit Card
    • Ashley Advantage Credit Card
    • Athleta Visa Credit Card
    • At Home Credit Card
    • Atwoods Credit Card
    • B&H Financing Credit Card
    • B&H Payboo Credit Card
    • Banana Republic Credit Card
    • Becker Furniture World Credit Card
    • Belk Rewards Credit Card
    • BERNINA Credit Card
    • Big Sandy Superstore Credit Card
    • Blain’s Farm & Fleet Rewards Mastercard
    • Bowflex Credit Card
    • bp Visa Credit Card
    • Briggs & Stratton Standby Power Credit Card
    • Cabinets To Go Credit Card
    • Canales Furniture Synchrony HOME Credit Card
    • Carpet One Floor & Home Credit Card
    • CITGO Rewards Card
    • City Furniture Credit Card
    • The Container Store Credit Card
    • Daniel’s Home Center Credit Card
    • Discount Tire Credit Card
    • DOCK86 Credit Card
    • DR Power Credit Card
    • Drive Savvy Rewards Credit Card
    • Driven Brands Credit Card
    • DX Engineering Super Card
    • eBay Mastercard
    • eBay Extras Mastercard
    • Electronic Express Credit Card
    • Fleet Rewards Visa Credit Card
    • Flooring America Credit Card
    • Furniture Row Gold Credit Card
    • Freedom To Ride Credit Card
    • Gabberts Credit Card
    • Gap Visa Credit Card
    • Generac Credit Card
    • Guitar Center Credit Card
    • Havertys Credit Card
    • HOM Furniture Credit Card
    • Hudson’s Furniture Credit Card
    • Husqvarna Credit Card
    • JCPenney Credit Card
    • Jerome’s Synchrony HOME Credit Card
    • Jewelry Exchange Credit Card
    • Jiffy Lube Credit Card
    • Kane’s Preferred Platinum Card
    • Kiesel Guitars Credit Card
    • Kraft Music Credit Card
    • KwikComfort Financing Credit Card
    • La-Z-Boy Furniture Galleries Credit Card
    • Leisure Pro Credit Card
    • Lighting One Credit Card
    • Lowe’s Advantage Credit Card
    • Lumber Liquidators Credit Card
    • Mathis Brothers Credit Card
    • Mattress Firm Credit Card
    • Mattress Warehouse Synchrony HOME Credit Card
    • Mavis Discount Tire Credit Card
    • McCoy’s Consumer Credit Card
    • Meineke Credit Card
    • Metro Mattress Credit Card
    • Midas Credit Card
    • Mitsubishi Electric Credit Card
    • Mohawk Flooring Credit Card
    • Morris Home Furnishings More For You Credit Card
    • Musician’s Friend Platinum Credit Card
    • NAPA EasyPay Credit Card
    • Nautilus Credit Card
    • Newegg Store Credit Card
    • Old Navy Visa Credit Card
    • Pandora Preferred Credit Card
    • PayPal Cashback Mastercard
    • PayPal Credit
    • PayPal Extras Mastercard
    • P.C. Richard & Son Credit Card
    • Pearle Vision Credit Card
    • Pep Boys Synchrony Car Care Credit Card
    • Precision Tune Auto Care Synchrony Car Care Credit Card
    • Puronics Credit Card
    • Regency Furniture Credit Card
    • Rooms To Go Credit Card
    • Sam Ash Credit Card
    • Sam’s Club Mastercard
    • ScoreRewards Credit Card
    • Sewing & More Credit Card
    • Sheely’s Furniture & Appliance Credit Card
    • ShopHQ Credit Card
    • Sleep Experts Credit Card
    • Sleep Number Credit Card
    • Sleep Outfitters Credit Card
    • Sony Financial Services Credit Card
    • Stein Mart Credit Card
    • Summit Racing Equipment SpeedCard
    • Sunglass Hut Credit Card
    • Sutherlands Friends of the Family Plus Credit Card
    • Sweetwater Card
    • Synchrony Car Care Credit Card
    • Synchrony HOME Credit Card
    • Synchrony Sport Credit Card
    • System Pavers Credit Card
    • Techron Advantage Credit Card
    • The Dump Credit Card
    • Tire Discounters Traction Credit Card
    • Tire Pros Preferred Customer Credit Card
    • Tire-Rama Credit Card
    • TJX Rewards Platinum Mastercard
    • Town Fair Tire Credit Card
    • Tuffy Tire and Auto Service Credit Card
    • US Appliance Credit Card
    • Value City Furniture Credit Card
    • Vaughan-Bassett Credit Card
    • Verizon Visa Card
    • Vintage King Audio Credit Card
    • Woodwind & Brasswind Credit Card

    Other Synchrony Bank offers

    Synchrony Bank might specialize in retail credit cards, but it also offers a number of additional consumer financial products, such as money market accounts, IRA CDs and other types of credit (like travel rewards cards, medical credit cards and even automaker-branded cards).

    Non-retail Synchrony Bank credit cards include:

    Most popular Synchrony Bank cards

    Synchrony’s diverse list of retail partners means you’re likely to find at least one store credit card worth considering. As with all types of debt, though, think through the potential advantages (purchase discounts and special offers) and drawbacks (such as a new hard inquiry, plus the potential to overspend) before deciding whether to apply for another card.

    Below are some of the most popular Synchrony Bank credit cards among the issuer’s current lineup.

    Lowe’s Advantage Credit Card

    If you’re a do-it-yourselfer, the Lowe’s Advantage Credit Card could make a handy addition to your toolbelt. With no annual fee, 20% off your first purchase (for an up to $100 discount) and an automatic 5% discount on all other purchases, you could end up saving some serious cash as you spruce up your abode.

    A caveat: The ongoing 5% savings can’t be combined with the card’s special financing offers, so you’ll have to pick one or the other. Unless you’re taking on a pretty big renovation, the immediate discount is your best bet – it eliminates the risk you’ll have to pay a ton of deferred interest if you have a remaining balance at the end of the promo period.

    See related: Best credit card for home improvement

    Sam’s Club Mastercard

    If more road trips than flights are in your future, the Sam’s Club Mastercard is perfect for swiping at the pump. The card offers a generous 5% cash back rate on gas purchased at Sam’s Club and most other fuel stations. You’ll also score 3% cash back on dining purchases, which can take some of the sting out of those fast-food visits between stops. (And when you’re ready to return to the skies, 3% cash back on travel isn’t too shabby either.)

    Unlike other cash back credit cards, though, rewards earned with the Sam’s Club Mastercard are issued as a check just once a year, in February.

    Verizon Visa Card

    Longtime Verizon customers (or those willing to switch carriers) might want to consider the Verizon Visa Card, which offers strong rewards in several everyday spending categories – a rarity among retail cards. Cardholders get 4% back on grocery store and gas purchases, 3% back on dining purchases, 2% back on Verizon purchases (including devices and monthly bills) and 1% back on all other spending.

    The downside is that your rewards are issued as Verizon Dollars, which can only be redeemed for Verizon purchases, such as a new phone or your monthly service bill. If you’d rather trade in your cash back for, well, cash, you’ll have to look elsewhere.

    PayPal Cashback Mastercard

    Like the Verizon Visa, the PayPal Cashback Mastercard is a “diamond in the rough” among store credit cards. In fact, it rivals one of our highest-rated flat-rate cash back cards – the Citi® Double Cash Card – thanks to unlimited 2% cash back on every purchase (1% when you buy, plus an additional 1% as you pay for those purchases), no minimum redemption requirements and no annual fee to eat into your earnings.

    Unless you’re a frequent PayPal user, though, the extra steps needed to claim your rewards may be a bit cumbersome – rewards can only be redeemed as statement credits to your PayPal account. And cardholders who are adept at finding the best travel redemptions may be able to earn a higher rewards rate with a more flexible cash back card.

    Rakuten Cash Back Visa Credit Card

    The Rakuten Cash Back Visa Credit Card rewards you with 3% cash back on qualifying purchases made through Rakuten.com, In-Store Cash Back offers, Rakuten Hotels and Rakuten travel. The ability to stack those rewards with cash back offers at Rakuten’s affiliate stores – which regularly feature rates of up to 5% or more – makes this a lucrative card for Rakuten die-hards. As an open-loop card, it also earns 1% cash back on all other purchases.

    Despite its inflexible redemption program, the Rakuten card deserves a closer look if you’re an American Express cardholder. Pairing it with an eligible Amex card could earn you 3x Membership Rewards points on top of those earned through a Rakuten cash back offer

    How to apply for a Synchrony Bank card

    The easiest way to apply for Synchrony Bank credit cards is online. Go to MySynchrony.com, then click “Where to Shop” at the top of the page. You can search for a specific retailer, browse through the bank’s partnering stores or filter cards by shopping category, such as home furnishings or sporting goods. If you find a card you’re interested in, click “Apply” and supply the requested information.

    List of Synchrony Bank credit cards

    Many of Synchrony’s partner stores also let you apply online or through their own websites. Alternatively, you can visit a merchant in person and request an application from an employee. Some cards offer one-time, same-day discounts upon credit approval, so you may want to wait until you’re ready to make a big purchase in order to maximize your savings.

    Should you apply for a Synchrony Bank card?

    Admittedly, retail credit cards can be a mixed bag. Between high interest rates and confusing deferred-interest promotions, you could find yourself deep in debt if you’re not careful. That said, if you need to build or rebuild credit – or you’re a particularly loyal shopper who could regularly save money from purchase discounts and special sales – a store-branded Synchrony Bank credit card could work in your favor.

    But if you’d rather avoid the temptation to overspend at your favorite retailer, you might be better off with a traditional credit-building credit card. Whichever route you take, remember the cardinal rule of responsible credit use: Never charge more than you can afford to pay in full every month.

    See related: Can you transfer a store card balance to a credit card?

    Editorial Disclaimer

    The editorial content on this page is based solely on the objective assessment of our writers and is not driven by advertising dollars. It has not been provided or commissioned by the credit card issuers. However, we may receive compensation when you click on links to products from our partners.

    Kelli Pate is a freelance writer and copy editor living in Kansas City, though she's a Jersey girl at heart. When she's not writing about personal finance and credit cards, she's immersing herself in the world of travel hacking.

    Источник: https://www.creditcards.com/credit-card-news/synchrony-bank-credit-cards/

    Does PC Richards have free delivery?

    Does PC Richards have free delivery?

    Free in-home delivery includes unpacking, and basic set-up. Please call (877) 727-1909 for additional appliance delivery and installation options.

    Where can I use my PC Richards credit card?

    Available for online and in-store purchases at 66 locations, the P.C. Richard & Son Credit Card can be used for thousands of appliance and electronics products, as well as mattresses and bedding.

    Is it hard to get a PC Richards credit card?

    Pc Richards Credit Card is a great Credit Card if you have fair credit (or above). Their APR is quite high (above 20%). If you’re looking to apply, we recommend at least a 630 credit score. If you’re not sure what your Credit Score is, apply for a report, here.

    How do I pay my synchrony bank bill?

    On the mysynchrony.com log in page, tap the Pay Without Log In button and then:

    1. Select your payment amount.
    2. Select your payment method.
    3. Review and authorize your payment.

    Can I pay synchrony bank with debit card?

    How can I pay my Synchrony Bank bill? You can pay them directly on this website. Or pay on doxo with credit card, debit card, Apple Pay or bank account.

    Is Capital One a synchrony bank?

    Synchrony Bank, as part of Synchrony Financial, is one of the major issuers of store credit cards in the U.S., along with Comenity Bank. When people talk about credit card issuers you usually hear names like American Express, Chase, Capital One, and Citi — but Synchrony is actually quite big.

    Does PayPal credit affect your credit score 2020?

    PayPal Credit does report to the credit Bureaus and will affect your credit score. Late payments will be reported to Experian specifically. PayPal Credit used to be considered a “hidden tradeline” as it did not report any activity.

    What happens if you don’t pay PayPal credit?

    Originally Answered: What happens if you don’t pay PayPal credit? The same thing that happens if you don’t pay any other credit. They report it to the credit agencies, likely resulting in a reduction of your credit score.

    Does PayPal pay in 3 affect credit score?

    Yes. PayPal says that, as a responsible lender, it will report a customer’s performance to credit reference agencies when necessary. So make sure you can keep up with repayments or it could affect your credit score.

    Источник: https://boardgamestips.com/faq/does-pc-richards-have-free-delivery/

  • "Easy to use and incredible customer support and love the 90-day option"

    Julie

    Salt Lake City, UT

    FAQs